The frequency matrix for alternative (not muscle gene) sp-1 sites... 2.0 0.0 1.0 0.0 0.0 1.0 0.0 0.0 2.0 0.0 0.0 1.0 0.0 0.0 0.0 0.0 7.0 0.0 1.0 2.0 1.0 6.0 6.0 6.0 9.0 10.0 10.0 0.0 10.0 9.0 6.0 8.0 1.0 1.0 4.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 1.0 3.0 The resulting weight matrix... -0.24 -2.06 -0.88 -2.06 -2.06 -0.88 -2.06 -2.06 -0.24 -2.06 -2.06 -0.88 -2.06 -2.06 -2.06 -2.06 1.24 -2.06 -0.88 -0.24 -0.88 1.05 1.05 1.05 1.57 1.71 1.71 -2.06 1.71 1.57 1.05 1.42 -0.88 -0.88 0.54 -2.06 -2.06 -2.06 -0.24 -2.06 -2.06 -2.06 -0.88 0.20 The frequency matrix was generated by aligning the sp-1 sites within the following list using a Gibbs sampling algorithim. > human cyp21b M12793 agggccactctgtgggtgggtcggtgggaa ggcacctgag > human egfr X06370 ggcaccgctcccctcccatgcgccgccccactcccgccg > M17704 Porcine growth hormone gene. ggaacaggatgagtgggaggaggttctaaattatccatta > Mouse tissue plasminogen activator gene, M26065 ccccgcccacacctctggccccaccccttcttcatccttc > mouse thymidylate synthase M29309 gctgtaaccacttctgtcacgtgggggcggggtctgccac > Rat transforming growth factor alpha (TGF-alpha), M31075 cagtgccaccgggaggcgcggtcgtccctccgcccgcgcg > human aldolase A X12447 tggctcgcctctcgggggcggcccgtagcccagtccgtcg > SV-40-III J02400 atgggcggaactgggcggagttaggggcgggatgggcgga > HSV-IE-3-III Herpes simplex virus (HSV) type 1 X14112 gatggcgcggatgggcggggccgggggttcgaccaacggg > human dhfr X00855 gtgcgccggggcgggggggcggggcctcgcctgcacaaat