The frequency matrix for alternative (not muscle gene)  tef sites...


   4.0  0.0  5.0  0.0  1.0  0.0  0.0  4.0
   0.0  5.0  0.0  0.0  2.0  4.0  4.0  0.0
   1.0  0.0  0.0  0.0  0.0  0.0  0.0  1.0
   0.0  0.0  0.0  5.0  2.0  1.0  1.0  0.0

The resulting weight matrix...

  1.33 -1.69  1.62 -1.69 -0.21 -1.69 -1.69  1.33
 -1.69  1.62 -1.69 -1.69  0.50  1.33  1.33 -1.69
 -0.21 -1.69 -1.69 -1.69 -1.69 -1.69 -1.69 -0.21
 -1.69 -1.69 -1.69  1.62  0.50 -0.21 -0.21 -1.69





The frequency matrix was generated by aligning the tef sites 
within the following list using a Gibbs sampling algorithim.  



>   SV40 putative late promoter region, artificial rearrangement in
GAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTCTTTCCGCCT
>   H.sapiens enhancer of gene hPL.
GCCCTCACTCCCTGAGATTCTGATATAATTAGACTGGAATGTGGTCCAGGCAAGAGTAGT 
>    HPV-16 enhancer sequence.  X66269
AATCACTATGCGCCAACGCCTTACATACCGCTGTTAGGCACATATTTTTGGCTTGTTTTA 
> human chorionic somatomammotropin-B gene enhancer ... 2 adjacent sites
AAATTTGAGATGCCTAGGATGTTTTCAAA