The frequency matrix for muscle gene Sp1 sites... (reverse complement sequence in paper) 0.0 3.0 2.0 1.0 0.0 0.0 4.0 0.0 0.0 0.0 0.0 6.0 4.0 8.0 10.0 12.0 12.0 0.0 12.0 12.0 12.0 11.0 5.0 2.0 2.0 1.0 0.0 0.0 6.0 0.0 0.0 0.0 1.0 1.0 3.0 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 The resulting weight matrix... -2.16 0.00 -0.43 -1.05 -2.16 -2.16 0.33 -2.16 -2.16 -2.16 -2.16 0.83 0.33 1.20 1.49 1.73 1.73 -2.16 1.73 1.73 1.73 1.62 0.60 -0.43 -0.43 -1.05 -2.16 -2.16 0.83 -2.16 -2.16 -2.16 -1.05 -1.05 0.00 -2.16 -2.16 -2.16 -2.16 -0.43 -2.16 -2.16 -2.16 -2.16 The frequency matrix was generated by aligning the Sp1 sites within the following list using a Gibbs sampling algorithim. Where possible two orthologous sites were obtained. To maintain equal weighting for each gene, two copies of Sp1 sites were included if no orthologous gene was available. > 1 actin-a cardiac human gtggcagaccgggccccccacccctgcccccggctgctccaactgaccctgtccat > 1 mouse aaggcaaggtggcagatcaggggccccccacccctgcccccggctgctccaactga > 2 TnC - slow mouse ggccaggggcagataacactgccccaccccctgcataccaaagtccccagcacaatcacca > 2 human gcacgcctgcttatcctgtgggagtccatggagccggggtggggacagccctccacccagtgcccataca > 3 cTnT chicken TCACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGCTCTGCCCGCCCCGGGGTGGGCGCCG > 3 cTnT chicken TCACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGCTCTGCCCGCCCCGGGGTGGGCGCCG > 4 skel a-actin rat AAATATGGCTTGGGAAGGGCAACAACATTCCTTCGGGCGGTGTGGAGAGCTCAGGACTATA > 4 cow ggggagcgacatcctgcggggcggcgcgaggggagcgcccgagggctatataaaacctgag > 5 anf human TTGGCAGCTTTATCACTGCAAGTGACAGAATGGGGAGGGTTCTGTCTCTCCTGCGT > 5 cow cactgcaagtgacagaatggggagggttccgtccctctcccggacgagctcccagagagc > myo d 6 sheep aagctcctccctgctctgttcctattggcctcgggcgcccccgcccctagccgctagctggggctcg > 6 mouse ccccaagctccgccctactacactcctattggcttgaggcgcccccgcccccagcctccctttccag