EST 1031217 is a singleton


Sequence

>1031217 (1 EST) Length=175 CCCAAGTTTGAGGAAACTTTAGTTCCCCCAAGAAGAATAAAGTTAAGTTGAAGCAACCAGCTGGTTACATAGGACCNGAT AAGAAGAAAAAATATATTNTTGTTTATATCTTCATCCTTCAATCATACTTCTTCTTCTTACTATTTCTGCAGACATTCAT ACGTTGATAGTAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1031217: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312172042853AA389867KJ4SLB219T3JHU93SL-BmL4 (JHU)


Date: 2:44:31 on Fri 24 Nov 117.