EST 1031221 is a singleton


Sequence

>1031221 (1 EST) Length=160 CCCAAGTTTGAGGTTTAAATATGTNGNAGAGAGGNCGAGGTCGAGCGNGNGGGGGAGCCAAATTTTGATTTCGTGGTCTC AGTTGGTCTGTATAATTGTCGACACCTGGCCAAATCTGTACTATGCGATATGATAGCGTTATCGTGCAGCCATGGTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1031221: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312212042857AA389871KJ4SLB283T3JHU93SL-BmL4 (JHU)


Date: 19:14:21 on Sun 19 Nov 117.