EST 1031222 is a singleton


Sequence

>1031222 (1 EST) Length=198 CCCAAGTTTGAGAAATGGNNNGGNGGACCTTNNTTTGTACGTTTNGTTTTGGCTTTGACCGTTTTTTGGGTGGTTGNTCA ACTGGTGGTGTNGGGAATTATTTTTTGATGTTACGGAAGAAATGAAAACTGCGCGAAAAAAATGGGAGAGTTTAAAATTA CGATGCGATGAACTTGAAAGAATTCGTCCAATCGAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1031222: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312222042858AA389872KJ4SLB289T3JHU93SL-BmL4 (JHU)


Date: 2:34:11 on Wed 22 Nov 117.