EST 1031223 is a singleton


Sequence

>1031223 (1 EST) Length=194 AAAAGAAATGTCCGTTAAGCAGTTCTTGNNCTTAATCTTACAAGTAACAAAAAATCAAAGTAAATCTCAAAGTAGACTAA GGATCTATAACCAAAAGAGTAAAATTGTTCAATAACTATCATAAGTTGCTGGTTTCTCCTTACGCAAGACGAACATGATC TAGATAGCGAAGCAGAGTCATAAGTTTAGAGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1031223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312232042859AA389873KJ4SLB291T3JHU93SL-BmL4 (JHU)


Date: 21:27:42 on Fri 24 Nov 117.