EST 1031231 is a singleton


Sequence

>1031231 (1 EST) Length=220 AATTACCCAAGTTTGAGAATGACATTGATGGTAGATCGTTTTAACAAGTGCTCTCGACTTCGTGATGGATCGATCGATCT GTCCTTGTATAGCAATTTCTGTGGTCTGTTATAACCTAAGATGTAATATCCAGAGGATGTCAGATCGTCATTGGACATTT CGGCAGATGCAGTACCTCGATTGTCGAGATCTATCATGATCAGTTCCACCAGCATCAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1031231: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312312042867AA389881KJ4SLB304T3JHU93SL-BmL4 (JHU)


Date: 15:1:51 on Sun 19 Nov 117.