EST 1031233 is a singleton


Sequence

>1031233 (1 EST) Length=231 AATTACCAAGTTTGAGTTCTCGGGACATTTCTGTCTCTTGTCGAGGTCTTACGTACGGTCTNNNAGATATGATCTCCTTC AGTATTTGTTGGAACTTGGCTTACAGTCGAGAGAGAGGATGTAGAGATTTCNNNGCAAGTCGGTCAGTAACAGTCTGCGA TCGTGTTGGATCGATCACAGGCGTCGTGTTGTTCCATCAATTAGAATGATACTGATCTAGGGACGACTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1031233: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312332042869AA389883KJ4SLB312T3JHU93SL-BmL4 (JHU)


Date: 4:32:28 on Mon 20 Nov 117.