EST 1031242 is a singleton


Sequence

>1031242 (1 EST) Length=255 CCCAAGTTTGAGGTTTAAATATGTGAAGAGAGGACGTGGTGGAGCGTGGGGAGCTAAATTTTGTATTTCGTTGGGCTNNA GTTGTGCTGTAATGAATTGTCCGGAAGCAACTGGAAAAAAATCTGTTCAAGTAATTGTGGTATATGGAATTAAGGGACGA ATTGAATTCGATTCCGAGACCGGTGGTATGATATGAAAGCAAGCTAGATGAGCTCTATGAAGCCCGAAGTCGAGTAGTGC TCTATATTTGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1031242: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10312422042878AA389892KJ4SLB337T3JHU93SL-BmL4 (JHU)


Date: 18:40:44 on Sat 18 Nov 117.