EST 1041075 is a singleton


Sequence

>1041075 (1 EST) Length=263 ATTGATTCAGCAGCTGCTTTAAGCTATTCAAGATGGTAAACTTCACCGTTGATGAGGTCCGTGCGCTCATGGACTACCCC GAACAGATCCGCAACATGTCCGTGATTGCACACGTTGATCACGGCAAGTCGACGTTGTCCGACTCGCTTGTGGGGGCTGC CGGTATCATCAAGATGGAGGATGCCGGTGACAAGCGCATCATGGACACCCGTGCCGACGAGATTGCGCGTGGNATTANGA TCAAGTCAACCGCCATTTCCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1041075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10410752053306AA399705TEUF0101T.cruzi epimastigote non-normalized cDNA Library


Date: 18:51:7 on Thu 23 Nov 117.