EST 1041076 is a singleton


Sequence

>1041076 (1 EST) Length=257 CTATATTGGGAAAAAGACATGGTCTTCCAGAAGAAGAAGGCGGAGGTGACGGTCCGCACGTCGCAGTTCAAGGTGAACAA GCTGCTCAACCGCAAGCAGTTCATCGTGGAGGTGAACCACCCCGGCTGGTGCGGCACCGTCCCCGCGAAACTCATCCGCA GCCGCCTCGCGTCGCTCTACAAGGTCGCCGACGAGAATCAGATTTCCGTCTTTGGCTTCAAGACGAAGTTTGGTGGGGCA AAGACGACCGGCTTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1041076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10410762053307AA399706TEUF0105T.cruzi epimastigote non-normalized cDNA Library


Date: 18:5:47 on Fri 17 Nov 117.