EST 1042982 is a singleton


Sequence

>1042982 (1 EST) Length=150 CGATCTATTAACTTTATGCATTTTCATTCTGTCAATTCATTACTCTCACTCAATTTTGCGATCGTTATTTTGAGATTTTN GATGAAATATGTTTCTTGTTACTCACTTTTTTCTGGAAATGTCAACAAATAAATGATCTGACGTACGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1042982: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10429822055213AA401612SWAMCA1670SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:50:12 on Wed 22 Nov 117.