EST 1042983 is a singleton


Sequence

>1042983 (1 EST) Length=155 GAGAGAGAGAATAGTCTCGAGTCTTTTTCTTTTCTTTTTTTTCTTTATTGTTTATTATACCTGTTGAATTGTTTTTNGCT TTTTNGCAAAGTTATATTTTTTTAACTNTGATTTGTATGTTTTTATTAAATATAATTTANTTTTAATTTACNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1042983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10429832055214AA401613SWAMCA1671SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:30:54 on Fri 17 Nov 117.