EST 1042989 is a singleton


Sequence

>1042989 (1 EST) Length=91 ATAATGCTATATGATTAATTTCTATATGACTTTTAATTTTCAGCCCTTTATATTTTGTTTTCCGATGTGTCACATTTCCC AAGCAAGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1042989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10429892055220AA401619SWAMCA1689SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:13:52 on Thu 23 Nov 117.