EST 1042993 is a singleton


Sequence

>1042993 (1 EST) Length=160 CGGCACGAGAGAAGAATAGTTCTCTCTCTCCTCGTGCCGCTCGTGCCGAATTCGGGANGAGCGGGNGAACANTTNGTCTA TTATCNCGGGCACGTATGTCCATTCTAATTCCATTAGTATTTATCTTTGTATTGTTAACTTTCGATAAAGCATATTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1042993: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10429932055224AA401623SWAMCA1703SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:59:3 on Sun 19 Nov 117.