EST 1044695 is a singleton


Sequence

>1044695 (1 EST) Length=383 AAAGGAAATGTTTAGGCGCAGCTTGTGCGTGTTTTCGTCATGACTTTTTCATGTGCTTAGTTTTTTTCTGACTTGCCTGT GGATTTAGGTGGGTGGGATGCTGGCACGGAGTTGTGGCGTACGGTGCACCATTTGGCGGTTCTTTGAAGGAGACGATGAG CCTTATTTTTATTTATTATTGTTATTATTATTCTCCAAATAATGGCGGTGTTTGCATCCCGCATCCTTTTGCCTGAATTT ACCTGCACAGTGGTCCCCACCCTTCAGCGCAGCAATATACATGCCACGCAGGGGCAAAAAAAAAAAAAAAGGGAACAGTG AAATTTAGGGAATGGCAACTTTGACAAAAATGTCTTTTAAATCTGTTTTGTATACATACACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1044695: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10446952055239AB003069AB003069Trypanosoma cruzi Y (Tomoo Tanaka)


Date: 16:6:24 on Tue 21 Nov 117.