EST 1048100 is a singleton


Sequence

>1048100 (1 EST) Length=330 TCATGGCTATATGTTGACGATGCAGCTGAAGGTATTCGAAAGGCCGTCGAAAGTGGAAAAATTCATGAAATTTACAACAT CGGAACTTATTTTGAAATGAATGTAATTGATCTTGCTCACGTTATACAAGCGGAAGTAGACCGGCAACTTGGACGAAGTC TAACCCCTGTGGAATTTGTTGGTATACTGGATCGGCCATATAACGATTTACGTTATCTGCTTGATTACAGTAAAATTAGT CTGGATACTGGTTGGTCACCAAAAGTGTCATTTGAAGAAGGCATTAGTCGAGTTATCGTTTCTGCATTAAATCTGCCTAA AAGGAGTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1048100: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10481002064747AA406781MBAFCZ4C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:18:22 on Wed 22 Nov 117.