EST 1048120 is a singleton


Sequence

>1048120 (1 EST) Length=331 GAGTTTCATTAGTTATGTCACGTGCAGTTCATCCATCCAGTGGCGTAATAACGATTGGAGGAAAAAGTGAATCTAAGGAC GAATCTTTCAAATTATCCGATTTGCAATCTTGTCGAAAATATGTGGCATTCCTGACTGTTGTTTATTTTCTGATGGTGCT TACTCAAGTGTGTAATCTTCTGTTTATGACATTTGCTGATCGAAATCCAACTATAAAAGATTTCTGTCGTAAGCAATATC CGAAATATATCGCAACAAAAAACTGCTCATCAACTGGTTCCTGCTGGGTGTTCATTAATGAATCCAAAGTGCTATGTACC ACAAGTCACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1048120: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10481202064767AA406710MBAFCZ4E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:53:4 on Mon 20 Nov 117.