EST 1048166 is a singleton


Sequence

>1048166 (1 EST) Length=406 CGATCATATAGTTTGCTTTTAACGATCTTCTTCAGTTCATCGGATTAGTCCCAATTTATTACTGGTTTGAATATTTATGT TTTATAAGGTTAATTTTAATCCTCATCACTTTCTCAAACAATCGTCCATTGTCAACATTTCCTTAACATCTGGAGCTTAA AGTTATGATTTTGATGTTCTTGTTTGATTTTCATTCCTGAAAAATAATTCTGTTACCATTTTCCCCTTTTTCTTGTTAAT TCAAATGAGGTAGTTATACGAACTGATGATTTTACTTTGGAGTTTCTCTTTGGTGAAGTTTTGTTTGAAAGTTCCTTTTT TTTCGCATTTACCCTCTTTTTGTTCTTTATAATTTTTTCAGTGAGCTTTGAGTCTGATGTGTTTATTGATGCTTGTAAAT TATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1048166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10481662064813AA406834MBAFCZ5F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:26:26 on Fri 17 Nov 117.