EST 1048232 is a singleton


Sequence

>1048232 (1 EST) Length=455 ATTATATTGGTGGAAGCAATATAATGCTTGAACAGTGATGAATATAAGTGGGAAATCGGGTAAAGCTGCCACGCGTGGCC AAAAGCAAATTTATGAAGAGAATCAAACTGTGATATTACATTACTCAACTGCTTCCATATTTTCTTCGGTTTTTTACATA CTGATTTCGGTATTTTTCTTTCAACGAACAACATGGGAATGGCTTGGTTTCTCTATTTGCTGTATGCTTGAAGTGGCAGC CATTCTAACTATGCGTTCTATGGCACGATGTCATCGTAATGAAAAAGGCCAAGTAACAGATGCTGGCTCAGATCTTAATC AGCCAGATGCTTTTGGAGAGTACTGTAAAGATGTGGTAATTTTATGCTCATTTGTTGCAATAGTAGCTACAATTTGGTCG ATGATTTTATGGCTCTTATTGTTAATTCCAGCTTATGTATTTTACAAACTATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1048232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482322064879AA406809MBAFCZ6E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:34:50 on Sun 19 Nov 117.