EST 1048236 is a singleton


Sequence

>1048236 (1 EST) Length=433 CTTCGCCGGAGTCTGAACGCGAGGGTACGGAGATTTTGCCGGTTTGGGAAATTTCAACAATTTTGAAAGCAGTGTTGATC ATCAACAACCACCACACATTGCAATGGACGAAGGAGCTACCCCTCAACCGCTTTCGGGCAACGGTCGTCGCTCGGGCAAC AGCACTTATAACTTGCAGCAGGAAATTATTTGGATTAAGCAAGATTCGGCTCAGATTCGCAACGCTGTTGTTCTGCTGGA AAAGGAAAAGGATAACTTACGACAAGCAGTTCGGAAACTCAAATTGGAAAACGCACGAGTGAAGCAGAAAGTAAAGCGCA TGCAGGAGACCATCAATGGGTTGAGTGGAGTATCAGCTGAAACAGATAATCTCAAAGTTGGGGCAACTGAGGCGGATTTG GATTATGACGATATTGGACGTGACTTCATTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1048236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482362064883AA406813MBAFCZ6E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:5:59 on Fri 24 Nov 117.