EST 1048316 is a singleton


Sequence

>1048316 (1 EST) Length=414 GTAAATTATATGAAATTTATTAAAATGTAATAATTCTGAATAAAATAAAATGTTCATTTAAAAATCAAACAAAACAACTT TGTATATTGCACAAAGCATAAAGTAACAAGTGGAGTGACCAATGAATTTTCAAAAATAACGTACAGATGCTCAATTATAT ACAACATGCACAAAATACTAAATAAGCAAATCAATATAAATATAGCATTTAATTTAATTATTATTTAAATACATTTCGTC CTCAACCTCGATGCATTCCCTCTCTTCCAGGCCTATACCTTGCTTCATGAATTGGTCCATTGCACAGGATGAAATCGGTT CCACTTTCGTCCACATTTGGATCAGGAACAAAAGCATAAGTTGGTGAATGTGAATTGCAACACTCTTCATTGATAATTTC CTCAATCATCCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1048316: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10483162064963AA406698MBAFCZ7D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:35:47 on Sun 19 Nov 117.