EST 1048356 is a singleton


Sequence

>1048356 (1 EST) Length=373 GGCAATCGCAGTTTAGGAAATGATATACGATTGCTAAGCAATCCAGTCAGTGCTTATCTGCTTATCAAAAGACTGATTGA GGAATGGGATGATATAAAACGGTTGGCAGGAAGTGATATTGGCGAAGAGTTATTGAAGGAAATTTCAGAATTACGAGCAA TGAATTATGTGAAAAACCCTACAACGGAAGATTTGGTTGGAGCTGCAATAGCCTTACTTCGGCTGCAAGATACATATCGG CTAAATGTTAAGGAGATAGCTGATGGGAAAATTCTGAATGCTTCTGGTGTTCAACCGTTTACAGCCAGGGATTGCTTTGA TATTGGTCGAGCAGCATACAATGTGAATGACTACTACCATACCTTAATATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1048356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10483562065003AA406985MBAFCZ7H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:28:44 on Sat 25 Nov 117.