EST 1061431 is a singleton


Sequence

>1061431 (1 EST) Length=466 GTTGTACTCGTGAGAAGCAGTGGTGCTGCACATTGGTGATCTAGTCTCAGTGTCATGTCAAAAGAGATAGTAGTTGTGAT ACCTATGGAAGATGGTGATCCATTAGGTGCTGTACCTAATGATAAACTTGTAATCGTCAAGATACAACAGGGTACTCTAG CAGATGGAAAGCTTAAGGTGGGTGATCAAATTCTTAAGGTAAACGATACGATAGTACGTGACACGGATCACTTTTATCAG TTACTTCGTTTTGCTCCACCGGTTGCGTCAATTATTCTGGTACGTGATGCAAAGAAAGCAGCTGAATTAGAAGCTAAAGT TCATATACCACCTGAACGAGCCAGATTAATCATACGTCGCGATGGATACACTTATTTTGTTGCTCGAATTGACTGGAAAC CTGGTGGTCCTAAGCTNGGTCTTGGTATTAAGCACTACCAGAATCCGTGTATTAGTATCGCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1061431: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614312078581AA417410RRAMCA1395SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:25:50 on Sun 19 Nov 117.