EST 1061432 is a singleton


Sequence

>1061432 (1 EST) Length=429 GGTCCAAATTTTCAGCAATATGAATTGGAATTGNCACAACGGGAGNAACGATTTNCATAAAAAATNTCGGCGCAGTTTTT TCGAGAATATGTCTCCACTGAATTCGTTTTCGGNAGATTCGGCATTTCTGACTTCTGACTCGTCGCCTGCAAGATGGNGG GGGNGGGGGGACATNCCAGCCAGTAATGAGCATGTATTATCAAATTCTGACGATGCAAATCCTATCTCGGATGTCTGCCA CTCGCCGAAAACTTCATCATCTAATAATATATTAGATTGTCGCTCCAGCGATCTTCCAAAAATTGGAAANAATGATGTCG CATCCTTGACAAATTTATCGGGTTAACTCAAATGATCTGGATGAAACCTTGCACTAGACGATGCATTTCGGGGACAAACA TCCCTGTGCACCTTACCAGCAGCACACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1061432: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614322078582AA417411RRAMCA1396SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:38:46 on Fri 24 Nov 117.