EST 1061435 is a singleton


Sequence

>1061435 (1 EST) Length=419 AGACAGTAATAATATATTCCTCTTTACTTCTGACTCTGGAGTAAGTTCATTTTTCAGTACTATTTTTTCATTACAATACT GTTTGTTTTTGTCATTTTTTAATATTCAGTATAGTTAGACATAATAAAATCAACTGCAAATAAATTTTCAGCTAATGTTC TCATCGAAATTGCTTGTTTGATCTTGCACAGTGGAAGTGGAAATTTAGGTCACAATTATCATGCGGTAGTACATTTTCTT TCTTGGTGCTGTGTATCTTTTCATTGCTCTTTAATAACTCTTTGCAGNGACAATTATCCTTTTCTTAATATGTTTTAGTT TCGATTATTCATTCATATAAATCAAAATTATTCTTCTCATGTATATGGTAGGAGTGATTGTACGAGAGAAAAATAACTTC TTTCTCATTTGTTATTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1061435: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614352078585AA417414RRAMCA1399SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:32:18 on Thu 23 Nov 117.