EST 1061440 is a singleton


Sequence

>1061440 (1 EST) Length=158 CCAAATTCCTATTTTTATTAGAAATAATATGCATAGGTGAAATTAGTTTGATATCATGATTCGTTTCAAGAGAAGTTTTG TGTGCTGAAAAGTTTGTTAAACATTGATCCTTGCAAATGGAAATTAAAGCTGTATATTTTGAGTAAATGTTTTCACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1061440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614402078590AA417419RRAMCA1404SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:22:40 on Fri 24 Nov 117.