EST 1061446 is a singleton


Sequence

>1061446 (1 EST) Length=451 GAGACAAAGGATGGAAGAAGATTCAGCAGAACGATATAATGAAATCGAAATGATGGATGATGAAGAGGGAAGAAAAAAGG CAAAAAATGGGAAGAAAAAGGTTTACATTCCTGGTGTAAGTCGTCCATTGCGTGAAGATGAAGATTGGGATTTTGATCCT GAAGCATATAACTTATATCACAGTTTTGAAACAAAGTGGCCTTGTCTTAGCTTTGACACAATTACTGATGATCTTGGCGA TAATCGTACTAGTTTCCCAATGAGCTGTTATTTGGTTGGCGGAACTCAAGCTGAGAAACCAACAAACAACGAGTTAATTG TGATGAAGCTGTCAAATTTGAATCCANTTGACGGTGATGAAGCGTCTGATAGCGAAAGATGAGCCTGAAGAAAATCCTCA AAACAAAGAACCTCAAACTTCACGCTGTAGCTATTCCACATATTGGCACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1061446: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614462078596AA417425RRAMCA1411SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:55:26 on Tue 21 Nov 117.