EST 1061460 is a singleton


Sequence

>1061460 (1 EST) Length=504 GCTCAGTGTTAGGGTTGTGCGAAACACAGATAATGGTGCCGTAGTTCTACTCCTTCCACTTAGTGCTTGCATTTCTCGTC CAATTTATAAAGCGAGCGATGATGATTTGGCTGTGGTATTGAAAAGTAATGAAAAAATTGTCTTAGACATGGAATGCTGC TGAGTTCGCTTACCTCGAAGTTCCTAGTTCACCAGGCAAATGCTGGTCCAGATACGAATGGATCTCAGTTCTTCTTATGC ACTGTGAAGACGGACTGGTTGGATGGTAAGCATGTTGTATTCGGCCGAGTTATCGAAGGAATGGATGTCGTACGGAAGAT TGAAGCAGTGGGTTCACAAAGCGGTAAGACATCGAAGGATGTAGTAATTGCAGATTGTGGACAATTGTAGAATGTCAAAC ATTAATTAATAACTCCAGAAGAAGTCTTCATTCTTGTTGGTTTATTCTCTGGATTAATTTCTCCCCTCNGTTCTCTCGNG ATGATTTTTCCGACATTTNCAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1061460: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614602078610AA417400RRAMCA1427SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:26:58 on Wed 22 Nov 117.