EST 1061471 is a singleton


Sequence

>1061471 (1 EST) Length=386 CTTCCTCGTTGACTGGTTGGTTCGCATTAGGAACTATTTNCTGGTGGGATGAACTGCTGAAGCTGACTGAAGCTAAATTG AATATGTATACAGAGCTAAAGGAACTGATCANTTTTCTGGCTATTTATATGCATCATCGAATTCCTCGGCGTCGGATTTG TCTGTTCATGGAAAGTTACAGCAATCATCTTGCGGCAAGATNTTTGGGGAAATGGAAGCCAGAAGAGCCAGANTATGGAG AAAAAGAGTGAACGTTGATGATTACCGCAGGAGATTGCCTAGATCAAATTCTCAGCACAATCGCAACAAGCATNGCNATA GTTGAAGAAGATCTCGCAGCGTGCCTCCCACCACTANTGATAGCTTACTGCATCCCTGGCGTCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1061471: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614712078621AA417437RRAMCA1439SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:54:7 on Wed 22 Nov 117.