EST 1061472 is a singleton


Sequence

>1061472 (1 EST) Length=182 CCATTTCGTAATTTTTTTTTCAATTTCTTTATGAATATTGAAACGTTTTATTTCACCCATATCAATATGCAACAGTTTTC GAACACTTATGAACTATATACTATGCAAATATTTCCAGAGGTATATTATACTTGAATGTTTTNCACTTACAAACAGATGA TATTTAATAAATATTGGAGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1061472: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10614722078622AA417438RRAMCA1440SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:3:59 on Mon 20 Nov 117.