EST 1068962 is a singleton


Sequence

>1068962 (1 EST) Length=304 AAACAGAAAGCATATATTTCTTTTCACACTAAGTATTACTTTTTTTCAAAAATAAAAAAGGAAGCAATAATGCTGTGGAA ATTATCAAGATGTACATTTGTTCGAAATCTTAAAACCCAAATTCTCAATGAATTCATCATCATATAAAACATTGATGATA TAACTGATAGCATGCAAACAATTCTAAAGTATGTTTATGATTTATCCACCAATAACAATCACCGTTTCATATGTATATCA CTGATTATTTCCAACATTAACACTTTGAACAGGGGACAGTATCAGGCATCATCTACCATATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1068962: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10689622103664AA424711EST0001S. mansoni cDNA adult worm (R.Guerra-Sa)


Date: 20:43:57 on Thu 23 Nov 117.