EST 1068966 is a singleton


Sequence

>1068966 (1 EST) Length=130 TCAAAAAACAATTGAATTATTACTGACAAAAACACAGACAAACAAAGGACGGAACGAGAAACGTGCAAGGAAAACAGGGA GAAGAAGGAACCGAAGAGAATGCACAGTCACAACGAAAACGAAGCCGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1068966: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10689662103668AA424715EST0009S. mansoni cDNA adult worm (R.Guerra-Sa)


Date: 17:17:9 on Fri 24 Nov 117.