EST 1070957 is a singleton


Sequence

>1070957 (1 EST) Length=330 CTGTACCCAAAACCAGCAAGATATGATGATGCAGCAACATTTTAACATGGACCAACTCCAATTTACGACGGAGTGGTNTA AGGACACCAAAGTCCAGTTGGACGCCCTGAAGGAGGCGACGAAGGGTCTTAAGCGGGAATTTAAGCGGGTGGATTTTTAA AAGATTGATAATATGCAGGAGGAATTGCTTGATCTGTACGAAGACACACAGGAGGTTCAGGAGGATCTTGGGCCGCGCCT ACGATGTGGCCGGAGGACATTTGACGAGGACGAGATGATGGGGGAGTTTGACGCACTTGCCATTTGACATGGAAAAGGAA CCCGACCCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1070957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709572107901AA426664TEUF0017T.cruzi epimastigote non-normalized cDNA Library


Date: 16:51:53 on Wed 22 Nov 117.