EST 1070958 is a singleton


Sequence

>1070958 (1 EST) Length=273 GCAGCCAATCCACAAGTTATTTCTGGAGGGAGCGATGGCATGATCTACTTGTGGGACATTGCATCCGGGCGTGCCTTTAC CCGTCTGACACGACATAAGAAACCCGTGCGAGGACTCGCTGTCAACCGCCAAGGAACACTAGCATCATGTGGGGCCGACA ACATCCGCGTCTGGTCTCTTCCGAAGGGAGAATTTCTTTTCAAACGCATCCACCAACAGCCACTGGGTAATAGTAAGGGG AGATGAGGAAGATAATTTGGTTATCCGCTGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1070958: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709582107902AA426665TEUF0172T.cruzi epimastigote non-normalized cDNA Library


Date: 9:45:20 on Thu 23 Nov 117.