EST 1070960 is a singleton


Sequence

>1070960 (1 EST) Length=117 CGCCAGATGGAGTTCCGCGCAATTCTGTTCGTGTCGAAGTGCGCGCCATTTGACATGCTTGAGCCCAGCAAGAAGCGCAA CAACATCAAGCTGTACGTGCGCCGCGTGTTCATCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1070960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709602107904AA426667TEUF0180T.cruzi epimastigote non-normalized cDNA Library


Date: 14:59:13 on Sun 19 Nov 117.