EST 1070963 is a singleton


Sequence

>1070963 (1 EST) Length=133 CCATTGAGGAAAGGAAGATCATGCTGTACACACAGAGAGGGTACGCCTTGGGGGAANACGCCAATATCGCTCTACCTTTG GGTGACGGACAACAACCGTTCTTTTTATGTTGGACCGGTTGCTATTGACGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1070963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709632107907AA426670TEUF0193T.cruzi epimastigote non-normalized cDNA Library


Date: 2:45:54 on Fri 24 Nov 117.