EST 1070964 is a singleton


Sequence

>1070964 (1 EST) Length=230 ATAAGTTTCTGTACTATATTGGCACACACACCACACACACACAAGATGCACATTGCAGTGGATATGAATGCACCTTTTGT GGTGCATGCTGGCAGTGCGTGTGGCGGCTGTTGTCTTTTCGTGGCCATGAGCAGGAGGGAGAGAGGACGCAGCCGAGACT ATTTCTGGCGGGTGTGATGAACGCGTGTGACTGCGCTGATTGGCTGGNGTCCATTATGCGGATGCAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1070964: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709642107908AA426671TEUF0196T.cruzi epimastigote non-normalized cDNA Library


Date: 7:16:52 on Sun 19 Nov 117.