EST 1070966 is a singleton


Sequence

>1070966 (1 EST) Length=71 GTTTCTTTTGCGTTGCGTGTGGCAGCAGCGTGTGGCGTGCTGCTTTTTCCCGTGGGCATGAAGCGAAGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1070966: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709662107910AA426673TEUF0206T.cruzi epimastigote non-normalized cDNA Library


Date: 22:7:9 on Fri 17 Nov 117.