EST 1070979 is a singleton


Sequence

>1070979 (1 EST) Length=198 CCAGCAAGCCATCACCAAAGGCTGCTCCCAAAAAGGCCGTGGCCGATTCCAGCAGCAACGACGAGCCGGTGCGCAACCCA GNAAGCCATCACCCAGGGCTGCTCCCAAAAAGGCCATGGCCGATTCCATCAGCAACGACGATGCCGGTGCATGNTTCTTC CAAACGGACTAGTCGTGCTGAAGAAGGGCGAGGGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1070979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709792107923AA426686TEUF0003T.cruzi epimastigote non-normalized cDNA Library


Date: 0:20:26 on Fri 24 Nov 117.