EST 1070985 is a singleton


Sequence

>1070985 (1 EST) Length=297 GTGACGGGTGTTCAACGCAGNCCCCGACGAGCCATTCCGGGCTCCCAACGGCACTGAGGCTGGGCTTGTCCGNCCCGNCG CGGCGGCGTCGACGTCGAACCTACTCTTCGTCCAGGTGTACATCGCGGGACACATGATGCCAATGAGTTCACNCAGCCTC TGNCTTTTTAATGATAAGCAACTTCCTGCAAGGAAGACCCTTCAATTAACGTGGACTGACTGTTTCCTTNTTTTTTTTTT TAANAAACTTGTTTTNCTTCGGCTTGTTTTTTTATGGACGGTGGNTAATANGGATGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1070985: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709852107929AA426692TEUF0053T.cruzi epimastigote non-normalized cDNA Library


Date: 16:30:40 on Sat 18 Nov 117.