EST 1070987 is a singleton


Sequence

>1070987 (1 EST) Length=308 NAGACTANANTACCGGTCCGAAATTCCCGGNTCNACCCACGNTTCCGGTAAGGCCAGGATTTCCTTGCAAATTAACAAGC TGTTGGCCGCCGCGCGNAAGNGGTNTTAAACGAGTAAGGCAGGCAAAAAGGTCTTTTTTTAACTNTCGGAATACTCGATT ATATACAAAACGTTTTTCCTTCCATCGTCTTGAGACAAACGCGGAAGCGGTGCCTGTCCTTCCGATCATTATTNANTCCA CCATGGAGTGGCTTACTGTTTCCTTCCTTTTAATGCCCCAAGACCCTTCAGCGGAGGGTTCGTAGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1070987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709872107931AA426694TEUF0064T.cruzi epimastigote non-normalized cDNA Library


Date: 6:56:46 on Sat 25 Nov 117.