EST 1070988 is a singleton


Sequence

>1070988 (1 EST) Length=168 GTACAGCGACACCACGGTACAGACTGACAAGAAGCTGCTGTCGTACGAGGTGGTGGCGGACAAGGACGGTAAGCCTAAGG TGCAGGTGGAGGTTGGCGGTAAGAAGAAGCAGTTCACGCCCGAGGAGGTGAGCCACGATGGTGCTGCAGAAGATGAAGCA GATCGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1070988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709882107932AA426695TEUF0067T.cruzi epimastigote non-normalized cDNA Library


Date: 9:27:42 on Sun 19 Nov 117.