EST 1070994 is a singleton


Sequence

>1070994 (1 EST) Length=331 GTGCCATCAAAGCACGGAAGAGCAAAAAGAATAAGAAAAACTAAACAATAAAAAGAAAACAAAAGCAAGAAGAAAAAAGA ACCTCTCAGAAATGTCAGGAACGGAGCATGACCAGTCAACGGATATCTTCTCTCCGGATGGTCGAGTCTTTCAGGTGGAA TACGCATGCAAGGCTGTTGACAATGGCAGTACGGCCGTTGCTGCGTGTTGCACCGACGGTGTGGTGGTTGCGGTAGAAAA GATTCTTACCAGCCGCATGCTTGGAGGAGAGGTCGAATTATCCGATTTCCACGCTGTAGATCCNCCAGGTTTGTGTCTGA ATTTTCGGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1070994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709942107938AA426701TEUF0086T.cruzi epimastigote non-normalized cDNA Library


Date: 4:30:24 on Wed 22 Nov 117.