EST 1070997 is a singleton


Sequence

>1070997 (1 EST) Length=282 CNTCGCCAAGGTGCAGCGCGCGGTTTGCATGATTGCNAACTCGACCGCCATCGCGGAGGTNTTCGCGCGCATCGACCACA AGTTCGACCTTATGTACAGCAAGCTTGCGTTCGTGCACTGGTACTTTGGTGAGGGTATGGAGGAGGGTGAGTTCTCGGAG GCCCGTGAAGGTTCTCGCCGCCCTGGAGAAGGACTACGAAGGAGGTCGGCGCAGAGTCCGCGGATATGGAGGGCGAGGAG GATGTGGAGGAGTACTAGAGTGGCCGTTCCCGTTTTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1070997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709972107941AA426704TEUF0096T.cruzi epimastigote non-normalized cDNA Library


Date: 23:54:47 on Sat 18 Nov 117.