EST 1075051 is a singleton


Sequence

>1075051 (1 EST) Length=423 AATTTTGAGTATTAAATATTCGCTAAAGTGTAAGTGTTGCTGAAAGCGTGGAAAGAAAATTTTCATTTTTTTGGGATATA TACCAAGGCACACTGCGAACTTCAGGAGATCTTACACCACTTTGGTATATTGTTGTCGGATTCCGTGCAGGTCGATTCTC GTTATAATCGCACACATCTGTGCCAGATTCTTGATGCACCGTAGTTCTGTATTCTGTGATTCGGATTGCACATTTTTCTG CCTTATAACTTGCATTAAGGAAGCGACGTTGTGAAATTTGACGAGTGGACCTTGAGAAACAAGAGGTGAAGCCTATATTA ATTTCATCAGATGCTTGTTGTGATTTCTTCAGCAAAAACTGGGTAAGAAAAGATTAGCTCCAACAAGAATGACTTCAAAA GAAGAACGCAAAGTATTGGCTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1075051: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10750512113528AA430758SWAMCA1764SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:6:42 on Wed 22 Nov 117.