EST 1075075 is a singleton


Sequence

>1075075 (1 EST) Length=495 GCAAATGACAAATGATGAAAGTAGACTTGTTACGGCAAGTAGTGATGGACGAATACGGATCTGGGAAGATATTTCTGAAA AAAAGCGCGAAGAAGAAGAACGTAATCGAGCAGAAAAGGCATATAGTGAACAAGTTCTGACAAATCTTATGCAGCAGAAT CATTATGCTGAAGCTTTAGCATTTTCACTAACACTGGCAAGACCATATAGCTGCTTGAAAATAGTGCAGAGGATGATGGA GTTAAAATCAAATGAATTGCACAGTGCGGTCAAAAAAATGCATAGTGAAGAGTTAGTAGTATTGCTGCACTTCGCCGCCC AGTGGAACACAAACAGTCGAACAGCAGATGTTGGTCAATTAGTGCTTTATTGCGTGTTGCATTCGNCCCCTCCCAAGGAG TTATTAAAAATGCCTAACTTTGCTTCAGTGATAGAAGCATATGTTCCATACACAACCAGGCATTTCGATCGGTTACAAGA GCGCGACAAAATGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1075075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10750752113552AA430795RRAMCA1462SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:25:13 on Fri 17 Nov 117.