EST 1075083 is a singleton


Sequence

>1075083 (1 EST) Length=365 ATACTGACGTTGTTGTTTTTCTCTGCCTGAACCACCACCGTGTATGGTTCTACCTATCTGTGCTGTTCGAAATTGCTTCT GGAGATCCCCTAAGTCACGGAAATGAAATGCTTCGGGTATTGCCGAAACCAAGGATTCTTGTGTGGCAAGAAGAATTCGA TCGTCCAGGATCTTCTGAAGCAGAATGAATTTAGTATGCAGCATAAAATTTACATACATGGCAGCAGGCCGCTCGTATAC AAATTCCCCGAAATTATAAACTTTCACTTCCTAATGGCTTTAATTCTCTCATGGTCGATAATAACATGCGACATTGTCTT GAAGTCGCAACCATTATCATCATGTTTTAGTGTTTGATATTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1075083: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10750832113560AA430878RRAMCA1470SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:56:17 on Thu 23 Nov 117.