EST 1075104 is a singleton


Sequence

>1075104 (1 EST) Length=455 GTGGATAACTGTGGCAATTCTAGAGCTAATACATGCACCAAAGCTCCGAATTTTAAACGAGCGCATCTATTAGATTAAAA CCAATCGGATTATTAATTTTAATCCGTTAATTGGTGACTCTGAATAGCTATGGCTGATCGCATGGTCTTGTACCGGCGAC GTATCTATCAAGTGTCTGCCTTATCAACTTTCGATGGTAGTTTATGTGCCTACCATGGTTGTAACGGGTAACGGAGAATA AGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAGTCTGGTGCCAG CAGNCGCGGTAATTCCAGCTCTCAAAGTGTATATCGTCATTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGCGTCTCAG GACTGCGTCCATCCATTGGGATGAGAAACTAGGCTCCCTAGGCTAATATTGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1075104: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751042113581AA430899RRAMCA1496SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:6:20 on Sat 18 Nov 117.